Review



plko rictor shrna 1 addgene sarbassov  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 91
      Buy from Supplier

    Structured Review

    Addgene inc plko rictor shrna 1 addgene sarbassov
    Plko Rictor Shrna 1 Addgene Sarbassov, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/addgene+plasmid+1853/pSB305-K3L-vac-HA+(Plasmid+%2320054)/pm37405918-135-76-79
    Average 91 stars, based on 1 article reviews
    plko rictor shrna 1 addgene sarbassov - by Bioz Stars, 2026-09
    91/100 stars

    Images

    Related Articles

    other:

    Article Title: LAMTOR1 depletion induces p53-dependent apoptosis via aberrant lysosomal activation
    Article Snippet: ShCtrl (Addgene plasmid 1864), ShRaptor (Addgene plasmid 1857) and ShRictor (Addgene plasmid 1853) plasmids were obtained from Dr. DM Sabatini laboratory.



    Similar Products

    plko rictor shrna 1 addgene sarbassov  (Addgene inc)
    91
    Addgene inc plko rictor shrna 1 addgene sarbassov
    Plko Rictor Shrna 1 Addgene Sarbassov, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/addgene+plasmid+1853/pSB305-K3L-vac-HA+(Plasmid+%2320054)/pm37405918-135-76-79
    Average 91 stars, based on 1 article reviews
    plko rictor shrna 1 addgene sarbassov - by Bioz Stars, 2026-09
    91/100 stars
    		  Buy from Supplier
    tacttgtgaagaatcgtatctt human rictor 2 addgene  (Addgene inc)
    93
    Addgene inc tacttgtgaagaatcgtatctt human rictor 2 addgene
    Tacttgtgaagaatcgtatctt Human Rictor 2 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/addgene+plasmid+1853/Rictor_1+shRNA+(Plasmid+%231853)/pmc06717289__pnas__1901765116__sapp-192-149-153
    Average 93 stars, based on 1 article reviews
    tacttgtgaagaatcgtatctt human rictor 2 addgene - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier
    addgene plasmid 1853  (Addgene inc)
    90
    Addgene inc addgene plasmid 1853
    Addgene Plasmid 1853, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/addgene+plasmid+1853/plasmid+1859/pmc03358017-114-9-10
    Average 90 stars, based on 1 article reviews
    addgene plasmid 1853 - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results